Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022F16

Clone ID RBdS022F16
HP ID HP08923
Gene ID 55902
Gene Symbol ACSS2
Protein Name acyl-CoA synthetase short-chain family member 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001076552.1
Length of RefSeq (bp) 2874
Chromosome 20q11.22
Reference DDBJ accession
UniGene Hs.517034
5'-terminal sequence GAAAGGCGGCCGCGGTTCTAGGAACTTGACGTGATGGGGCTTCCTGAGGAGCGGGTCCGG
2011.08.28