Prev. | 

RIKEN DNA Bank Human Resource - CBWD1

Gene ID NCBI Gene 55871 |  KEGG hsa:55871
Gene Symbol CBWD1
Protein Name COBW domain containing 1
Synonyms COBP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088445 IRAL021B21 pDNR-LIB BC013432 NM_018491 Full/var
HGY088511 IRAL021E15 pDNR-LIB BC005996 NM_018491 Full/var
HGY088587 IRAL021H19 pDNR-LIB BC009573 NM_018491 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057228 ARe43B04 pKA1U5 NM_018491.3  
GGCGGTACGGCGTGTTGGTCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGA
HKR330459 RBb26C11 pGCAP1 NM_018491.3  
GGTTGGTCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGAATGTTACCGGCT
HKR340852 RBb52C04 pGCAP1 NM_018491.3  
GCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGAATGTTACCGGCTGTTGGA
HKR341627 RBb54B03 pGCAP1 NM_018491.3  
GCCCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGAATGTTACCGGCTGTTG
HKR341779 RBb54H11 pGCAP1 NM_018491.3  
GAGTGGCGTGCTGGGCGTGCGCGGCTGCGGTACGGCGTGTTGGTCCCAGCGGTTCAGCTG
HKR343627 RBb59B03 pGCAP1 NM_018491.3  
GGCGGTTCAGCTGAGGTAGGGACGTGCCGTAGGCCGGAATGTTACCGGCTGTTGGATCTG
HKR376856 RBd42C08 pGCAP10 NM_018491.3  
GGGCGTGTTGGTCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGAATGTTAC
HKR382026 RBd55B02 pGCAP10 NM_018491.3  
GGCGGTACGGCGTGTTGGTCCCAGCGGTTCAGCTGAGGTAGGGNNNNGCTGTAGGCCGGA
HKR399680 RBd99D08 pGCAP10 NM_018491.3  
CGGCGGTACGGCGTGTTGGTCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGG
HKR402911 RBdS007E15 pGCAP10 NM_018491.3  
GCCCAGCGGTTCAGCTGAGGTAGGGACGTGCTGTAGGCCGGAATGTTACCGGCTGTTGGA
HKR420514 RBdS051E18 pGCAP10 NM_018491.3  
GAGAGCCCAGGTAATCCGGGCGGGATCAGCTAGCGTCGCGATGTGATGACGTCAGGCCCC
HKR475060 RBdS187K20 pGCAP10 NM_018491.3  
GGGGAGTGGCGTGCTGGGCGTGCGCGGCTGCGGTACGGCGTGTTGGTCCCAGCGGTTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl