Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051E18

Clone ID RBdS051E18
HP ID HP01095
Gene ID 55871
Gene Symbol CBWD1
Protein Name COBW domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018491.3
Length of RefSeq (bp) 1740
Chromosome 9p24.3
Reference DDBJ accession
UniGene Hs.645337
5'-terminal sequence GAGAGCCCAGGTAATCCGGGCGGGATCAGCTAGCGTCGCGATGTGATGACGTCAGGCCCC
2011.08.28