Prev. | 

RIKEN DNA Bank Human Resource - BEX1

Gene ID NCBI Gene 55859 |  KEGG hsa:55859
Gene Symbol BEX1
Protein Name brain expressed X-linked 1
Synonyms BEX2|HBEX2|HGR74-h
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096158 IRAL040G14 pOTB7 BC018615 NM_018476 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040802 ARe02A02 pKA1U5 NM_018476.3  
GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
HKR165329 ARi13F09 pGCAP10 NM_018476.3  
GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
HKR170146 ARi25G02 pGCAP10 NM_018476.3  
GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
HKR209418 ARiS023J02 pGCAP10 NM_018476.3  
TGACGTGACCGGGAGCTGCAGAGCTACGCAGCCTTCGGTGCAGTCGTCACTCGTGTCTCG
HKR243874 ARiS109L10 pGCAP10 NM_018476.3  
GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
HKR277713 ARiS194E17 pGCAP10 NM_018476.3  
GACTCGTGTTTCNCTNCCNNNTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
HKR334432 RBb36B08 pGCAP1 NM_018476.3  
AGAGCTACGCAGCCTTCGGTGCAGTCGTCACTCGTGTCTCGCTACCAGCTCCCCGCTGCC
HKR382080 RBd55D08 pGCAP10 NM_018476.3  
TGGCAGCCTTCGGTGCAGTCGTCACTCGTGTCTCGCTACCAGCNNNNNNGCNGCCCTGCG
HKR442073 RBdS105D01 pGCAP10 NM_018476.3  
GGGTGCAGTCGTCACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCT
HKR471180 RBdS177P20 pGCAP10 NM_018476.3  
GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl