Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177P20

Clone ID RBdS177P20
HP ID HP04676
Gene ID 55859
Gene Symbol BEX1
Protein Name brain expressed, X-linked 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018476.3
Length of RefSeq (bp) 862
Chromosome Xq21-q23
Reference DDBJ accession
UniGene Hs.334370
5'-terminal sequence GACTCGTGTCTCGCTACCAGCTCCCCGCTGCCCTGCGCTCGGCGCGCTGGCATCCGGCCC
2011.08.28