Prev. |  KEGG KO K20637 > 

RIKEN DNA Bank Human Resource - ARHGAP15

Gene ID NCBI Gene 55843 |  KEGG hsa:55843
Gene Symbol ARHGAP15
Protein Name Rho GTPase activating protein 15
Synonyms BM046
Ortholog resource in our bank

  ARHGAP15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032958 IRAK082G14 pCMV-SPORT6 BC038976 NM_018460 Full/var
HGY092842 IRAL032B18 pDNR-LIB BC016701 NM_018460 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096807 M01C042A07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE096855 M01C042C07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE096903 M01C042E07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE096951 M01C042G07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE096999 M01C042I07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE097047 M01C042K07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE097095 M01C042M07 pDONR221 MGC10-E04 BC016701 ENST00000295095  
HGE097143 M01C042O07 pDONR221 MGC10-E04 BC016701 ENST00000295095  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405783 RBdS014H15 pGCAP10 NM_018460.3  
GTCTTTCTTCCACCTTGAGAAGAAGGTGCCTTGCTTCCCCTTCGCCTTCCACCCTTACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl