Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014H15

Clone ID RBdS014H15
HP ID HP08875
Gene ID 55843
Gene Symbol ARHGAP15
Protein Name Rho GTPase activating protein 15
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018460.3
Length of RefSeq (bp) 1774
Chromosome 2q22.2
Reference DDBJ accession
UniGene Hs.171011
5'-terminal sequence GTCTTTCTTCCACCTTGAGAAGAAGGTGCCTTGCTTCCCCTTCGCCTTCCACCCTTACTG
2011.08.28