Prev. | 

RIKEN DNA Bank Human Resource - ANKRD10

Gene ID NCBI Gene 55608 |  KEGG hsa:55608
Gene Symbol ANKRD10
Protein Name ankyrin repeat domain 10
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028558 IRAK071G14 pBluescriptR BC034813 NM_017664 Partial/var
HGY082433 IRAL006B09 pOTB7 BC001727 NM_017664 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009212 W01A023A12 pENTR-TOPO IRAL006B09 BC001727 NM_017664  
HGE009216 W01A023A16 pENTR-TOPO IRAL006B09 BC001727 NM_017664  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442283 RBdS105L19 pGCAP10 NM_017664.2  
GGTGGGACGCGGCCGCGGCGCTAGTCTCGTTCCTTTGTGCTGCGGCGGCGGCTTCTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl