Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105L19

Clone ID RBdS105L19
HP ID HP09144
Gene ID 55608
Gene Symbol ANKRD10
Protein Name ankyrin repeat domain 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017664.2
Length of RefSeq (bp) 2495
Chromosome 13q34
Reference DDBJ accession
UniGene Hs.525163
5'-terminal sequence GGTGGGACGCGGCCGCGGCGCTAGTCTCGTTCCTTTGTGCTGCGGCGGCGGCTTCTCGAG
2011.08.28