Prev. | 

RIKEN DNA Bank Human Resource - CNOT11

Gene ID NCBI Gene 55571 |  KEGG hsa:55571
Gene Symbol CNOT11
Protein Name CCR4-NOT transcription complex subunit 11
Synonyms C2orf29|C40
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055902 IRAK139M14 pCMV-SPORT6 BC064421 NM_017546
HGY081056 IRAL002K16 pOTB7 BC018664 NM_017546 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096023 M01C040A23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096071 M01C040C23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096119 M01C040E23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096167 M01C040G23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096215 M01C040I23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096263 M01C040K23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096311 M01C040M23 pDONR221 MGC09-E12 BC064421 ENST00000289382  
HGE096359 M01C040O23 pDONR221 MGC09-E12 BC064421 ENST00000289382  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068927 ARe72F07 pKA1U5 NM_017546.4  
GGCTTTACGGCCGCGGGGACGGAGCGAGCCGGCGCCAGGGCCCCTCGGGCCGGGAAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl