Prev. |  Human A to Z list >  C >  CNOT11 > 

ARe72F07 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR068927
Clone Name ARe72F07
Clone info. Plasmid clone of human C2orf29 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGCTTTACGGCCGCGGGGACGGAGCGAGCCGGCGCCAGGGCCCCTCGGGCCGGGAAGAGG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_017546.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CNOT11 (NCBI Gene 55571)  other clone of CNOT11 in our bank
Synonyms C2orf29|C40
Protein Name CCR4-NOT transcription complex subunit 11
KEGG hsa:55571
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR068927 ARe72F07 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.19

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl