Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LAPTM4B

Gene ID (NCBI) 55353
Gene Symbol LAPTM4B
Protein Name lysosomal protein transmembrane 4 beta
Synonyms LAPTM4beta|LC27
Databases KEGG hsa:55353 |  NCBI Gene 55353
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12387)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY092253 IRAL030K13 pOTB7 BC014129 NM_018407 Partial
HGY096640 IRAL041J24 pDNR-LIB BC031021 NM_018407 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040499 ARe01E03 pKA1U5 NM_018407.4  
GGCCTTCGGAGCCAAGGGTACCGACCCGGCAGAATCTCGGAGCTCTCGGGGTATCGAGGA
HKR048953 ARe22G09 pKA1U5 NM_018407.4  
GCCCGTCCCCGCCGCTGCAGCCGATCGCCTTCGGAGNGAAGGGTACCGACCCGGCAGAAG
HKR180547 ARi51G03 pGCAP10 NM_018407.4  
GGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCG
HKR364921 RBd12F01 pGCAP10 NM_018407.4  
GCCCCGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAG
HKR330154 RBb25G10 pGCAP1 NM_018407.4  
GGTCCCCGCCGCTGCAGCCGTTCGCCTTCGGAGCGAAGGGNACCTTACCCGGCAGAAGCT
HKR333348 RBb33G04 pGCAP1 NM_018407.4  
AATGTGGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTCTCNGGGTATCGAGGAGGCA
HKR343332 RBb58F12 pGCAP1 NM_018407.4  
GCCGCTGCAGCCGATCGCCTTCGGAGCGAAGGGTACCGACCCGTNAGAAGCTCGGAGCTC
HKR380972 RBd52H04 pGCAP10 NM_018407.4  
GAGAAGCTCGGAGCTCTCGGGGTATCGAGGAGGCAGGCCCGCGGGCGCACGGGCGAGCGG
HKR344921 RBb62F01 pGCAP1 NM_018407.4  
TTAGCTCGGAGCTCTCGGGGTATCGAGGCAGGCAGGCCCGCCGNTNTCACGGGCGTAGCG
HKR345753 RBb64G09 pGCAP1 NM_018407.4 done
GGCCCCGCCCCCTCCCCGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCG
HKR385301 RBd63E05 pGCAP10 NM_018407.4  
GGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCG
HKR388075 RBd70D03 pGCAP10 NM_018407.4  
GAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTCTCGGGGTA
HKR390436 RBd76B12 pGCAP10 NM_018407.4  
GAGAAGCTCGGAGCTCTCGGGGTATCGAGGAGGCAGGCCCGCGGGCGCACGGGCGAGCGG
HKR403133 RBdS007N21 pGCAP10 NM_018407.4  
GGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCG
HKR409145 RBdS022O09 pGCAP10 NM_018407.4  
GGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTCTCGGGG
HKR461620 RBdS154A20 pGCAP10 NM_018407.4  
GGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.02

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl