Prev. |  Human A to Z list >  L >  LAPTM4B > 

RBb64G09 - NRCD Human cDNA Clone

Catalog Number HKR345753
Clone Name RBb64G09
Clone info. Plasmid clone of human LAPTM4B cDNA with SV40 promoter
Vector(1) pGCAP1
5'-terminal sequence(2) GGCCCCGCCCCCTCCCCGTCCCCGCCGCTGCAGCCGTCGCCTTCGGAGCGAAGGGTACCG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_018407.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) LAPTM4B (NCBI Gene 55353)  other clone of LAPTM4B in our bank
Synonyms LAPTM4beta|LC27
Protein Name lysosomal protein transmembrane 4 beta
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR345753 RBb64G09 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb64G09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR345753).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBb64G09a.seq   RBb64G09c.seq   RBb64G09.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl