Prev. |  KEGG KO K06158 > 

RIKEN DNA Bank Human Resource - ABCF3

Gene ID NCBI Gene 55324 |  KEGG hsa:55324
Gene Symbol ABCF3
Protein Name ATP binding cassette subfamily F member 3
Synonyms EST201864
Ortholog resource in our bank

  ABCF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039453 IRAK098K13 pCMV-SPORT6 BC051754 NM_018358 Full/var
HGX031697 IRAK079E01 pCMV-SPORT6 BC035652 NM_018358 Full/var
HGX044041 IRAK110B17 pCMV-SPORT6 BC051884 NM_018358 Full/var
HGY084318 IRAL010N06 pOTB7 BC009253 NM_018358 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264583 ARiS161H15 pGCAP10 NM_018358.2  
GAGGCCGGGGTCTCACAGCGACTGCGCGGACGGGTTCCTGAGTGGAACATGGCGACTTGC
HKR453018 RBdS132J02 pGCAP10 NM_018358.2  
GCTGAGTGGAACATGGCGACTTGCGCCGAAATCCTGCGGAGCGAGTTCCCCGAAATTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl