Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABCF3

Gene ID (NCBI) 55324
Gene Symbol ABCF3
Protein Name ATP-binding cassette, sub-family F (GCN20), member 3
Synonyms EST201864
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06158)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX031697 IRAK079E01 pCMV-SPORT6 BC035652 NM_018358 Full/var
HGX039453 IRAK098K13 pCMV-SPORT6 BC051754 NM_018358 Full/var
HGX044041 IRAK110B17 pCMV-SPORT6 BC051884 NM_018358 Full/var
HGY084318 IRAL010N06 pOTB7 BC009253 NM_018358 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264583 ARiS161H15 pGCAP10 NM_018358.2  
GAGGCCGGGGTCTCACAGCGACTGCGCGGACGGGTTCCTGAGTGGAACATGGCGACTTGC
HKR453018 RBdS132J02 pGCAP10 NM_018358.2  
GCTGAGTGGAACATGGCGACTTGCGCCGAAATCCTGCGGAGCGAGTTCCCCGAAATTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl