Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132J02

Clone ID RBdS132J02
HP ID HP06056
Gene ID 55324
Gene Symbol ABCF3
Protein Name ATP-binding cassette, sub-family F (GCN20), member 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018358.2
Length of RefSeq (bp) 2652
Chromosome 3q27.1
Reference DDBJ accession
UniGene Hs.361323
5'-terminal sequence GCTGAGTGGAACATGGCGACTTGCGCCGAAATCCTGCGGAGCGAGTTCCCCGAAATTGAC
2011.08.28