Prev. |  KEGG KO K08967 > 

RIKEN DNA Bank Human Resource - ADI1

Gene ID NCBI Gene 55256 |  KEGG hsa:55256
Gene Symbol ADI1
Protein Name acireductone dioxygenase 1
Synonyms APL1|ARD|Fe-ARD|HMFT1638|MTCBP1|Ni-ARD|SIPL|mtnD
Ortholog resource in our bank

  ADI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081877 IRAL004L13 pOTB7 BC001467 NM_018269 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE050986 W01A127H18 pENTR-TOPO IRAL004L13 BC001467 NM_018269  
HGE050992 W01A127H24 pENTR-TOPO IRAL004L13 BC001467 NM_018269  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078035 ARe95B11 pKA1U5 NM_018269.2  
GGAGCGCGGCCCCTGGGTTCGAACACGGCACCCGCACTGCGCGTCATGGTGCAGGCCTGG
HKR186003 ARi65A03 pGCAP10 NM_018269.2  
GGAGCGCGGCCCCTGGGTTCGAACACGGCACCCGCACTGCGCGTCATGGTGCAGGCCTGG
HKR323249 RBb08C01 pKA1U5 NM_018269.2  
GGCGCGGCCCCTGGGTTCGAACACGGCACCCGCACTGCGCGTCATGGTGCAGGCCTGGTA
HKR433422 RBdS083J06 pGCAP10 NM_018269.2  
GGAGCGCGGCCCCTGGGTTCGAACACGGCACCCGCACTGCGCGTCATGGTGCAGGCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl