Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083J06

Clone ID RBdS083J06
HP ID HP03536
Gene ID 55256
Gene Symbol ADI1
Protein Name acireductone dioxygenase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018269.2
Length of RefSeq (bp) 1685
Chromosome 2p25.3
Reference DDBJ accession
UniGene Hs.502773
5'-terminal sequence GGAGCGCGGCCCCTGGGTTCGAACACGGCACCCGCACTGCGCGTCATGGTGCAGGCCTGG
2011.08.28