Prev. |  KEGG KO K15620 > 

RIKEN DNA Bank Human Resource - GOLPH3L

Gene ID NCBI Gene 55204 |  KEGG hsa:55204
Gene Symbol GOLPH3L
Protein Name golgi phosphoprotein 3 like
Synonyms GPP34R
Ortholog resources KEGG ortholog (KEGG orthology K15620) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085700 IRAL014E04 pOTB7 BC013870 NM_018178 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379250 RBd48C02 pGCAP10 NM_018178.5  
GATTCCTTCTCTGCATCGAAGGATCAGGAAGTTTGTGCTCTCTGCGTGGCTAAGTTTTTC
HKR441717 RBdS104E21 pGCAP10 NM_018178.5  
GGCGTGGCTAANTTTTTCACCTACTAGGACGGGGGTGGGGTGGGGAGAACAGGTGTCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl