Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104E21

Clone ID RBdS104E21
HP ID HP08440
Gene ID 55204
Gene Symbol GOLPH3L
Protein Name golgi phosphoprotein 3-like
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018178.5
Length of RefSeq (bp) 3208
Chromosome 1q21.3
Reference DDBJ accession
UniGene Hs.646007
5'-terminal sequence GGCGTGGCTAANTTTTTCACCTACTAGGACGGGGGTGGGGTGGGGAGAACAGGTGTCCTT
2011.08.28