Prev. |  KEGG KO K09680 > 

RIKEN DNA Bank Human Resource - PANK1

Gene ID NCBI Gene 53354 |  KEGG hsa:53354
Gene Symbol PANK1
Protein Name pantothenate kinase 1
Synonyms PANK
Ortholog resources KEGG ortholog (KEGG orthology K09680) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061702 ARe54E06 pKA1U5 NM_148977.1  
GGCGCGGCCTGGGGATCAGGGGAAGGCGGGCGGCGGGAGCCCCGGCTGGGGGTGCGCGGG
HKR235455 ARiS088K15 pGCAP10 NM_148977.1  
GATCCCCAGGCGCCGGCTCTGCGGCTGCTGAATCGGAAGCCGCAGGGAGGATCCGGGGAA
HKR430169 RBdS075H01 pGCAP10 NM_148977.1  
GAGGACTGGGCATGCTCAGTGGCGGGGACCAGTCTGGGAGGCGAGGAAGCCGCGTTTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl