Prev. |  KEGG KO K14403 > 

RIKEN DNA Bank Human Resource - CPSF3

Gene ID NCBI Gene 51692 |  KEGG hsa:51692
Gene Symbol CPSF3
Protein Name cleavage and polyadenylation specific factor 3
Synonyms CPSF-73|CPSF73
Ortholog resource in our bank

  CPSF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030566 IRAK076G22 pBluescriptR BC043432 NM_016207 Partial
HGY087160 IRAL017O24 pOTB7 BC011654 NM_016207 Full/var
HGY092051 IRAL030C03 pOTB7 BC014106 NM_016207 Partial
HGY096317 IRAL040N05 pOTB7 BC020211 NM_016207

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218381 ARiS045P21 pGCAP10 NM_016207.2  
GGCCGCGNGCTCCGGAGTGACGGAAGTTGTGCTCTTGGTGAATGGGGTTCTTCCTTTTTT
HKR442377 RBdS105P17 pGCAP10 NM_016207.2  
GGGAAGTTGTGCTCTTGGTGAATGGGGTTCTTCCTTTTTTATTTACCGGTGGCTGTGCTT
HKR470890 RBdS177D18 pGCAP10 NM_016207.2  
GCTTCCTTTTTTATTTACCGGTGGCTGTGCTTCCAATTTAGGAAGACCCCGGCGACCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl