Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105P17

Clone ID RBdS105P17
HP ID HP03580
Gene ID 51692
Gene Symbol CPSF3
Protein Name cleavage and polyadenylation specific factor 3, 73kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016207.2
Length of RefSeq (bp) 2286
Chromosome 2p25.1
Reference DDBJ accession
UniGene Hs.515972
5'-terminal sequence GGGAAGTTGTGCTCTTGGTGAATGGGGTTCTTCCTTTTTTATTTACCGGTGGCTGTGCTT
2011.08.28