Prev. |  KEGG KO K10733 > 

RIKEN DNA Bank Human Resource - GINS2

Gene ID NCBI Gene 51659 |  KEGG hsa:51659
Gene Symbol GINS2
Protein Name GINS complex subunit 2
Synonyms HSPC037|PSF2|Pfs2
Ortholog resource in our bank

  GINS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082488 IRAL006D16 pOTB7 BC003186 NM_016095 Full
HGY091069 IRAL027L05 pOTB7 BC010164 NM_016095 Full
HGY100759 IRAL051O23 pDNR-LIB BC062444 NM_016095 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004561 W01A011G17 pENTR-TOPO IRAL006D16 BC003186 NM_016095  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR020508 ARa51E12 pKA1U5 NM_016095.2  
TTGGCGGGAAAACGGCGGCCGCGGCGTCTCCTCCGGGACGCTGAGGGGCCCGAGGAGACC
HKR371727 RBd29F07 pGCAP10 NM_016095.2  
GAGACCGTGAGGCTCTGGCCTGCAGCTCGCGCCGCCATGGACGCTGCCGAGGTCGAATTC
HKR381347 RBd53G03 pGCAP10 NM_016095.2  
GGNGACGCTGAGGGNNCCGAGGACACCGAGAGGCTCTGNNCTGCANGTCGCGCCGNCNNG
HKR384554 RBd61G10 pGCAP10 NM_016095.2  
GAGGAGACCGTGAGGCTCTGGCCTGCAGCTCGCGCCGCCATGGACGCTGCCGAGGTCGAA
HKR387777 RBd69H09 pGCAP10 NM_016095.2  
GGGGGCGGGCTCTCGCCGTGGCGGGAAAACGGCGGCCGCGGCGTCTCCTCCGGGACGCTG
HKR428005 RBdS070A05 pGCAP10 NM_016095.2  
GGAGGCTCTGGCCTGCAGCTCGCGCCGCCATGGACGCTGCCGAGGTCGAATTCCTCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl