Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070A05

Clone ID RBdS070A05
HP ID HP04531
Gene ID 51659
Gene Symbol GINS2
Protein Name GINS complex subunit 2 (Psf2 homolog)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016095.2
Length of RefSeq (bp) 1196
Chromosome 16q24.1
Reference DDBJ accession
UniGene Hs.433180
5'-terminal sequence GGAGGCTCTGGCCTGCAGCTCGCGCCGCCATGGACGCTGCCGAGGTCGAATTCCTCGCCG
2011.08.28