Prev. | 

RIKEN DNA Bank Human Resource - FAM96B

Gene ID NCBI Gene 51647 |  KEGG hsa:51647
Gene Symbol FAM96B
Protein Name family with sequence similarity 96 member B
Synonyms CGI-128|CIA2B|MIP18
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082619 IRAL006J03 pOTB7 BC001733 NM_016062 Full
HGY087405 IRAL018I13 pOTB7 BC005023 NM_016062 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042549 ARe06G05 pKA1U5 NM_016062  
GGGTAGGCGGCGGCGGGGTCGGCGGCGGCCTCCTGGAGAATGCCAACCCCCTCATCTACC
HKR056449 ARe41C01 pKA1U5 NM_016062  
GGGTGGTGGTTCCGCGATGGTAGGCGGCGGCGNGGTTCGGCGGCGGCCTCCTGGAGAATG
HKR063372 ARe58H04 pKA1U5 NM_016062  
GGGTGGTGGTTCCGCGAATGGTAGGCGGCGGCGGGGTCGGCGGCGGCCTCCTGGAGAATG
HKR372402 RBd31A02 pGCAP10 NM_016062  
GAGGATCAGCGGTGGTGGTTCCGCGATGGTAGGCGGCGGCGGGGTCGGCGGCGGCCTCCT
HKR393235 RBd83B11 pGCAP10 NM_016062  
GAGCGCACGCCTGCTAGGATCAGCGGTGGTGGTTCCGCGATGGTAGGCGGCGGCGGGGTC
HKR395724 RBd89F04 pGCAP10 NM_016062  
CGGGCGGCCGATAGCGGGTGGCACCGCGGCCGCGGATCTCCCTTTAGTGAGGGTTAATTG
HKR461855 RBdS154K15 pGCAP10 NM_016062  
GGGTGGTGGTTCCGCGATGGTAGGCGGCGGCGGGGTCGGCGGCGGCCTCCTGGAGAATGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl