Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154K15

Clone ID RBdS154K15
HP ID HP04731
Gene ID 51647
Gene Symbol FAM96B
Protein Name family with sequence similarity 96, member B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016062
Length of RefSeq (bp) 670
Chromosome 16q22.1-q22.3
Reference DDBJ accession
UniGene Hs.9825
5'-terminal sequence GGGTGGTGGTTCCGCGATGGTAGGCGGCGGCGGGGTCGGCGGCGGCCTCCTGGAGAATGC
2011.08.28