Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOP58

Gene ID (NCBI) 51602
Gene Symbol NOP58
Protein Name NOP58 ribonucleoprotein
Synonyms NOP5|NOP5/NOP58
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14565)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027802 IRAK069I10 pCMV-SPORT6 BC032592 NM_015934
HGY083394 IRAL008I02 pOTB7 BC001707 NM_015934 Partial/var
HGY090741 IRAL026O05 pOTB7 BC009306 NM_015934 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386152 RBd65G08 pGCAP10 NM_015934.3  
GAGTAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTC
HKR441899 RBdS104M11 pGCAP10 NM_015934.3  
GAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl