Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104M11

Clone ID RBdS104M11
HP ID HP02893
Gene ID 51602
Gene Symbol NOP5/NOP58
Protein Name nucleolar protein NOP5/NOP58
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015934.3
Length of RefSeq (bp) 1979
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.471104
5'-terminal sequence GAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCAT
2011.08.28