Prev. | 

RIKEN DNA Bank Human Resource - AZIN1

Gene ID NCBI Gene 51582 |  KEGG hsa:51582
Gene Symbol AZIN1
Protein Name antizyme inhibitor 1
Synonyms AZI|AZI1|AZIA1|OAZI|OAZIN|ODC1L
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082892 IRAL007D20 pOTB7 BC013420 NM_148174 Full
HGY083883 IRAL009L19 pOTB7 BC019279 NM_148174 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053771 ARe34H03 pKA1U5 NM_148174.2  
GACACTTTCAGGCTCTGATCGCGGCCGCAGTTTTTCCTTTTTTCTTCTGCCGTCGCCTTC
HKR222204 ARiS055I12 pGCAP10 NM_148174.2  
GACACTTTCAGGCTCTGATCGCGGCCGCAGTTTTTCCTTTTTTCTTCTGCCGTCGCCTTC
HKR335633 RBb39B09 pGCAP1 NM_148174.2  
GTGACACTTTCAGGCTCTGAATCGCGGCCGCAGTTTTTCCTTTTTTCTTCTGCCGTCGCC
HKR405801 RBdS014I09 pGCAP10 NM_148174.2  
GACACTTTCAGGCTCTGATCGCGGCCGCAGTTTTTCCTTTTTTCTTCTGCCGTCGCCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl