Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014I09

Clone ID RBdS014I09
HP ID HP05105
Gene ID 51582
Gene Symbol AZIN1
Protein Name antizyme inhibitor 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_148174.2
Length of RefSeq (bp) 4202
Chromosome 8q22.3
Reference DDBJ accession
UniGene Hs.459106
5'-terminal sequence GACACTTTCAGGCTCTGATCGCGGCCGCAGTTTTTCCTTTTTTCTTCTGCCGTCGCCTTC
2011.08.28