Prev. | 

RIKEN DNA Bank Human Resource - JKAMP

Gene ID NCBI Gene 51528 |  KEGG hsa:51528
Gene Symbol JKAMP
Protein Name JNK1/MAPK8 associated membrane protein
Synonyms C14orf100|C24orf100|CDA06|HSPC213|HSPC327|JAMP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086569 IRAL016H01 pDNR-LIB BC005198 NM_016475 Partial
HGY087724 IRAL019F04 pDNR-LIB BC010359 NM_016475

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080850 ARf02C02 pKA1U5 NM_016475.3  
GGCTGATCTAGTGCTTCTCGAAAAAAACCTTCAGGCGGCCCATGGCTGTCGATATTCAAC
HKR428311 RBdS070M23 pGCAP10 NM_016475.3  
GAAACCCGGAAGCGAGGGAGGAACTTCGGAGCTGTCGCCCGGGTTACCGGGAGGCGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl