Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070M23

Clone ID RBdS070M23
HP ID HP04611
Gene ID 51528
Gene Symbol C14orf100
Protein Name chromosome 14 open reading frame 100
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016475.3
Length of RefSeq (bp) 2377
Chromosome 14q23.1
Reference DDBJ accession
UniGene Hs.446850
5'-terminal sequence GAAACCCGGAAGCGAGGGAGGAACTTCGGAGCTGTCGCCCGGGTTACCGGGAGGCGGAGC
2011.08.28