Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CHMP5

Gene ID (NCBI) 51510
Gene Symbol CHMP5
Protein Name charged multivesicular body protein 5
Synonyms C9orf83|HSPC177|PNAS-2|SNF7DC2|Vps60
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086426 IRAL016B02 pDNR-LIB BC006974 NM_016410 Full/var
HGY086772 IRAL016P12 pDNR-LIB BC007457 NM_016410 Full/var
HGY092615 IRAL031I23 pDNR-LIB BC021168 NM_016410 Full/var
HGY093016 IRAL032I24 pDNR-LIB BC016698 NM_016410 Full
HGY094005 IRAL035A05 pDNR-LIB BC020796 NM_016410 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054027 ARe35B03 pKA1U5 NM_016410.3  
GTTGGGTTTCTTCGCGGCTGCTCAAGATGAACCNACTCTTCGGGAAAGCGAAACCCAAGG
HKR208004 ARiS020A04 pGCAP10 NM_016410.3  
GGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGC
HKR235348 ARiS088G04 pGCAP10 NM_016410.3  
CGGCCGGCCGATGGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAG
HKR327274 RBb18D02 pKA1U5 NM_016410.3  
GGGAAGTCGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTT
HKR370406 RBd26A06 pGCAP10 NM_016410.3  
GGGCCGGAAGTCGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTG
HKR334150 RBb35G06 pGCAP1 NM_016410.3  
GACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGA
HKR388146 RBd70G02 pGCAP10 NM_016410.3  
GGTTTGGGTTTCTTCGCGGCTGCTCAAGATGAACCGACTCTTCGGGAAAGCGAAACCCAA
HKR441761 RBdS104G17 pGCAP10 NM_016410.3  
GGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGATGAAC
HKR452821 RBdS132A21 pGCAP10 NM_016410.3  
GACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl