Prev. |  KEGG KO K12198 > 

RIKEN DNA Bank Human Resource - CHMP5

Gene ID NCBI Gene 51510 |  KEGG hsa:51510
Gene Symbol CHMP5
Protein Name charged multivesicular body protein 5
Synonyms C9orf83|CGI-34|HSPC177|PNAS-2|SNF7DC2|Vps60
Featured content Endocytosis (human)
Ortholog resource in our bank

  CHMP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086426 IRAL016B02 pDNR-LIB BC006974 NM_016410 Full/var
HGY086772 IRAL016P12 pDNR-LIB BC007457 NM_016410 Full/var
HGY092615 IRAL031I23 pDNR-LIB BC021168 NM_016410 Full/var
HGY093016 IRAL032I24 pDNR-LIB BC016698 NM_016410 Full
HGY094005 IRAL035A05 pDNR-LIB BC020796 NM_016410 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054027 ARe35B03 pKA1U5 NM_016410.3  
GTTGGGTTTCTTCGCGGCTGCTCAAGATGAACCNACTCTTCGGGAAAGCGAAACCCAAGG
HKR208004 ARiS020A04 pGCAP10 NM_016410.3  
GGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGC
HKR235348 ARiS088G04 pGCAP10 NM_016410.3  
CGGCCGGCCGATGGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAG
HKR327274 RBb18D02 pKA1U5 NM_016410.3  
GGGAAGTCGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTT
HKR334150 RBb35G06 pGCAP1 NM_016410.3  
GACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGA
HKR370406 RBd26A06 pGCAP10 NM_016410.3  
GGGCCGGAAGTCGAGGCGGGAGTGACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTG
HKR388146 RBd70G02 pGCAP10 NM_016410.3  
GGTTTGGGTTTCTTCGCGGCTGCTCAAGATGAACCGACTCTTCGGGAAAGCGAAACCCAA
HKR441761 RBdS104G17 pGCAP10 NM_016410.3  
GGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGATGAAC
HKR452821 RBdS132A21 pGCAP10 NM_016410.3  
GACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl