Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132A21

Clone ID RBdS132A21
HP ID HP04065
Gene ID 51510
Gene Symbol CHMP5
Protein Name chromatin modifying protein 5
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016410.3
Length of RefSeq (bp) 1432
Chromosome 9p13.3
Reference DDBJ accession
UniGene Hs.635313
5'-terminal sequence GACTCTGCTTCCGTTTCTGGTTTTGCTCTAGTGTTTGGGTTTCTTCGCGGCTGCTCAAGA
2011.08.28