Prev. |  KEGG KO K14415 > 

RIKEN DNA Bank Human Resource - RTCB

Gene ID NCBI Gene 51493 |  KEGG hsa:51493
Gene Symbol RTCB
Protein Name RNA 2',3'-cyclic phosphate and 5'-OH ligase
Synonyms C22orf28|DJ149A16.6|FAAP|HSPC117
Ortholog resource in our bank

  RTCB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001277 IRAK003D05 pCMV-SPORT6 BC000151 NM_014306 Full/var
HGX001392 IRAK003H24 pCMV-SPORT6 BC010308 NM_014306 Full
HGY083405 IRAL008I13 pOTB7 BC002970 NM_014306 Full
HGY092926 IRAL032F06 pDNR-LIB BC016707 NM_014306 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346975 RBb67H07 pGCAP1 NM_014306.4  
GGGACTACGCGGCAGCGGCTCTTCAAAGCGGAGCCGGGAGTTTTTGCTACAGTTTTCGCC
HKR395228 RBd88B04 pGCAP10 NM_014306.4  
GAGTTTTTGCTACAGTTTTCGCCACCATGAGTCGCAGCTATAATGATGAGCTGCAGTTCT
HKR453024 RBdS132J08 pGCAP10 NM_014306.4  
GGGTGCTCTGAGAAGCCGGACTACGCGGCAGCGGCTCTTCAAAGCGGAGCCGGGAGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl