Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132J08

Clone ID RBdS132J08
HP ID HP05989
Gene ID 51493
Gene Symbol C22orf28
Protein Name chromosome 22 open reading frame 28
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014306.4
Length of RefSeq (bp) 2081
Chromosome 22q12
Reference DDBJ accession
UniGene Hs.474643
5'-terminal sequence GGGTGCTCTGAGAAGCCGGACTACGCGGCAGCGGCTCTTCAAAGCGGAGCCGGGAGTTTT
2011.08.28