Prev. |  KEGG KO K06104 > 

RIKEN DNA Bank Human Resource - AMOTL2

Gene ID NCBI Gene 51421 |  KEGG hsa:51421
Gene Symbol AMOTL2
Protein Name angiomotin like 2
Synonyms LCCP
Ortholog resource in our bank

  AMOTL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005054 IRAK012K14 pCMV-SPORT6 BC011454 NM_016201 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077603 ARe94A03 pKA1U5 NM_016201.2  
GGGGGCGCGAACAGCCAGAGCGTCGGCGCCACGGCCGAGAACACATCTTCGCCGCCGAGC
HKR238696 ARiS096M08 pGCAP10 NM_016201.2  
GGGAACCTGAAACTCTCACATTCCTGGCATANCANCCGCCTCCGGCGCGGGCCGACNCTG
HKR428306 RBdS070M18 pGCAP10 NM_016201.2  
GAGCCGCCTCCGGCGCGGGCCGACCCTGGGGCTGCGCGCTGGGGCGCGAACAGCCAGAGC
HKR432631 RBdS081J15 pGCAP10 NM_016201.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl