Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070M18

Clone ID RBdS070M18
HP ID HP06304
Gene ID 51421
Gene Symbol AMOTL2
Protein Name angiomotin like 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016201.2
Length of RefSeq (bp) 4984
Chromosome 3q21-q22
Reference DDBJ accession
UniGene Hs.426312
5'-terminal sequence GAGCCGCCTCCGGCGCGGGCCGACCCTGGGGCTGCGCGCTGGGGCGCGAACAGCCAGAGC
2011.08.28