Prev. |  KEGG KO K07565 > 

RIKEN DNA Bank Human Resource - NIP7

Gene ID NCBI Gene 51388 |  KEGG hsa:51388
Gene Symbol NIP7
Protein Name nucleolar pre-rRNA processing protein NIP7
Synonyms CGI-37|HSPC031|KD93
Ortholog resource in our bank

  NIP7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006380 IRAK015P20 pCMV-SPORT6 BC015941 NM_016101 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013432 W01A033J16 pENTR-TOPO IRAK015P20 BC015941 NM_016101  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243754 ARiS109G10 pGCAP10 NM_016101.3  
GACCGACTTCCGTTTCCAGTTACCAAGGCACGAGGATCCGGTGTTCCAACCCAGGGGGAA
HKR361303 RBd03E07 pGCAP10 NM_016101.3  
GGGTGTTCCAACCCAGGGGGAAAAATGCGGCCTTTGACTGAAGAGGAGACCCGTGTCATG
HKR387609 RBd69A09 pGCAP10 NM_016101.3  
GAGTTACCAAGGCACGAGGATCCGGTGTTCCAACCCAGGGGGAAAAATGCGGCCTTTGAC
HKR428360 RBdS070O24 pGCAP10 NM_016101.3  
GGAGGATCCGGTGTTCCAACCCAGGGGGAAAAATGCGGCCTTTGACTGAAGAGGAGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl