Prev. |  Human A to Z list >  N >  NIP7 > 

RBd69A09 - NRCD Human cDNA Clone

Catalog Number HKR387609
Clone Name RBd69A09
Clone info. Plasmid clone of human NIP7 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GAGTTACCAAGGCACGAGGATCCGGTGTTCCAACCCAGGGGGAAAAATGCGGCCTTTGAC
Sequence, submitted(3) n.a.
 
Sequence, refered NM_016101.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) NIP7 (NCBI Gene 51388)  other clone of NIP7 in our bank
Synonyms CGI-37|HSPC031|KD93
Protein Name nucleolar pre-rRNA processing protein NIP7
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR387609 RBd69A09 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd69A09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR387609).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl