Prev. | 

RIKEN DNA Bank Human Resource - GOLM1

Gene ID NCBI Gene 51280 |  KEGG hsa:51280
Gene Symbol GOLM1
Protein Name golgi membrane protein 1
Synonyms C9orf155|GOLPH2|GP73|HEL46|PSEC0257|bA379P1.3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082695 IRAL006M07 pOTB7 BC001740 NM_177937 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178497 ARi46E01 pGCAP10 NM_016548.2  
GGCGGAGGCGCTGGGCGCACGGCGCGGAGCCGGCCGGAGCTCGAGGCCGGCGGCGGCGGG
HKR375300 RBd38E04 pGCAP10 NM_016548.2  
GGGACGCGGAGGCGCTGGGCGCACGGCGCGGAGCCGGCCGGAGCTCGAGGCCGGCGGCGG
HKR452835 RBdS132B11 pGCAP10 NM_016548.2  
GAGGCCGGAGACGCGGCGGCGCTGGACGCGGAGGCGCTGGGCGCACGGCGCGGAGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl