Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132B11

Clone ID RBdS132B11
HP ID HP07548
Gene ID 51280
Gene Symbol GOLM1
Protein Name golgi membrane protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016548.2
Length of RefSeq (bp) 3080
Chromosome 9q21.33
Reference DDBJ accession
UniGene Hs.494337
5'-terminal sequence GAGGCCGGAGACGCGGCGGCGCTGGACGCGGAGGCGCTGGGCGCACGGCGCGGAGCCGGC
2011.08.28