Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APIP

Gene ID (NCBI) 51074
Gene Symbol APIP
Protein Name APAF1 interacting protein
Synonyms APIP2|CGI29|MMRP19
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08964)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005578 IRAK013P18 pCMV-SPORT6 BC009077 NM_015957 Full/var
HGY081435 IRAL003J19 pOTB7 BC017594 NM_015957 Full/var
HGY088429 IRAL021B05 pDNR-LIB BC008440 NM_015957 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062412 ARe56A12 pKA1U5 NM_015957.2  
GCCCGCCCCCGGGCTGCCCTCAGCGCCGCCNGACTTGTATTTGCGGCCTCGCTGCCGCAT
HKR062501 ARe56E05 pKA1U5 NM_015957.2  
TGGCGCGCAAAGCCGATGCGGAGATTGGAGGCCGCNCTNAATCCCTGGTCTGGGCCATGT
HKR471044 RBdS177K04 pGCAP10 NM_015957.2  
GATCCCAGGCTAAGCGCCGCGCGCAAAGCCGTGCGGAGATTGGAGGCCGCGCGGGTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl