Prev. |  KEGG KO K08964 > 

RIKEN DNA Bank Human Resource - APIP

Gene ID NCBI Gene 51074 |  KEGG hsa:51074
Gene Symbol APIP
Protein Name APAF1 interacting protein
Synonyms APIP2|CGI-29|CGI29|MMRP19|hAPIP
Ortholog resource in our bank

  APIP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005578 IRAK013P18 pCMV-SPORT6 BC009077 NM_015957 Full/var
HGY081435 IRAL003J19 pOTB7 BC017594 NM_015957 Full/var
HGY088429 IRAL021B05 pDNR-LIB BC008440 NM_015957 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062412 ARe56A12 pKA1U5 NM_015957.2  
GCCCGCCCCCGGGCTGCCCTCAGCGCCGCCNGACTTGTATTTGCGGCCTCGCTGCCGCAT
HKR062501 ARe56E05 pKA1U5 NM_015957.2  
TGGCGCGCAAAGCCGATGCGGAGATTGGAGGCCGCNCTNAATCCCTGGTCTGGGCCATGT
HKR471044 RBdS177K04 pGCAP10 NM_015957.2  
GATCCCAGGCTAAGCGCCGCGCGCAAAGCCGTGCGGAGATTGGAGGCCGCGCGGGTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl