Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177K04

Clone ID RBdS177K04
HP ID HP05566
Gene ID 51074
Gene Symbol APIP
Protein Name APAF1 interacting protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015957.2
Length of RefSeq (bp) 1266
Chromosome 11p13
Reference DDBJ accession
UniGene Hs.447794
5'-terminal sequence GATCCCAGGCTAAGCGCCGCGCGCAAAGCCGTGCGGAGATTGGAGGCCGCGCGGGTCCCT
2011.08.28