Prev. |  KEGG KO K18666 > 

RIKEN DNA Bank Human Resource - ASCC1

Gene ID NCBI Gene 51008 |  KEGG hsa:51008
Gene Symbol ASCC1
Protein Name activating signal cointegrator 1 complex subunit 1
Synonyms ASC1p50|CGI-18|SMABF2|p50
Ortholog resource in our bank

  ASCC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008496 IRAK021D24 pCMV-SPORT6 BC012291 NM_015947 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038947 W01A097G03 pENTR-TOPO flj0025g14 AK094170 NM_015947  
HGE038949 W01A097G05 pENTR-TOPO flj0025g14 AK094170 NM_015947  
HGE048280 W01A120L16 pENTR-TOPO flj0025g14 AK094170 NM_015947  
HGE048282 W01A120L18 pENTR-TOPO flj0025g14 AK094170 NM_015947  
HGE048284 W01A120L20 pENTR-TOPO flj0025g14 AK094170 NM_015947  
HGE048286 W01A120L22 pENTR-TOPO flj0025g14 AK094170 NM_015947  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR433304 RBdS083E08 pGCAP10 NM_015947.2  
GGCACTCGGTCAAACCCGGCCTGGGGAAATTTCCTATCGCACGTCTGCTGCAGCAGTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl