Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083E08

Clone ID RBdS083E08
HP ID HP09077
Gene ID 51008
Gene Symbol ASCC1
Protein Name activating signal cointegrator 1 complex subunit 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015947.2
Length of RefSeq (bp) 2090
Chromosome 10pter-q25.3
Reference DDBJ accession
UniGene Hs.500007
5'-terminal sequence GGCACTCGGTCAAACCCGGCCTGGGGAAATTTCCTATCGCACGTCTGCTGCAGCAGTCTC
2011.08.28