Prev. |  KEGG KO K12581 > 

RIKEN DNA Bank Human Resource - CNOT7

Gene ID NCBI Gene 29883 |  KEGG hsa:29883
Gene Symbol CNOT7
Protein Name CCR4-NOT transcription complex subunit 7
Synonyms CAF-1|CAF1|Caf1a|hCAF-1
Ortholog resources KEGG ortholog (KEGG orthology K12581) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02859 pGA-human caf1 cDNA clone of human CAF1/CNOT7

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053522 IRAK133N10 pBluescript BC060852 NM_054026 Full/var
HGY081548 IRAL003O12 pOTB7 BC007315 NM_054026 Partial/var
HGY102955 IRAL057G11 pDNR-LIB BC070187 NM_054026 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182475 ARi56D03 pGCAP10 NM_013354.5  
GGCAGCTCCTGCTCGCCTTTCCCTTCGCTGGGCGAGAGGTGTCTATGGGGCACCCGCTGC
HKR260195 ARiS150I03 pGCAP10 NM_013354.5  
AAAAAGCGACGGCGCAGCACGGTGCGGCGCAGCTCCTGCTCGCCTTTCCCTTCGCTGGGC
HKR409040 RBdS022J24 pGCAP10 NM_013354.5  
GGCAGCTCCTGCTCGCCTTTCCCTTCGCTGGGCGAGAGGTGTCTATGGGGCACCCGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl