Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022J24

Clone ID RBdS022J24
HP ID HP02669
Gene ID 29883
Gene Symbol CNOT7
Protein Name CCR4-NOT transcription complex, subunit 7
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_013354.5
Length of RefSeq (bp) 2646
Chromosome 8p22-p21.3
Reference DDBJ accession
UniGene Hs.719129
5'-terminal sequence GGCAGCTCCTGCTCGCCTTTCCCTTCGCTGGGCGAGAGGTGTCTATGGGGCACCCGCTGC
2011.08.28