Prev. |  KEGG KO K12194 > 

RIKEN DNA Bank Human Resource - CHMP4A

Gene ID NCBI Gene 29082 |  KEGG hsa:29082
Gene Symbol CHMP4A
Protein Name charged multivesicular body protein 4A
Synonyms C14orf123|CHMP4|CHMP4B|HSPC134|SHAX2|SNF7|SNF7-1|VPS32-1|VPS32A
Featured content Endocytosis (human)
Ortholog resource in our bank

  CHMP4A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087948 IRAL019O12 pDNR-LIB BC010893 NM_014169 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330849 RBb27C01 pGCAP1 NM_014169.2  
GGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCTCGGCAGGCTCTTCGGGAAGGGGAA
HKR433411 RBdS083I19 pGCAP10 NM_014169.2  
TGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl