Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CHMP4A

Gene ID (NCBI) 29082
Gene Symbol CHMP4A
Protein Name charged multivesicular body protein 4A
Synonyms C14orf123|CHMP4|CHMP4B|HSPC134|SHAX2|SNF7|SNF7-1|VPS32-1|VPS32A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087948 IRAL019O12 pDNR-LIB BC010893 NM_014169 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330849 RBb27C01 pGCAP1 NM_014169.2  
GGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCTCGGCAGGCTCTTCGGGAAGGGGAA
HKR433411 RBdS083I19 pGCAP10 NM_014169.2  
TGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl