Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083I19

Clone ID RBdS083I19
HP ID HP02182
Gene ID 29082
Gene Symbol CHMP4A
Protein Name chromatin modifying protein 4A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014169.2
Length of RefSeq (bp) 1505
Chromosome 14q12
Reference DDBJ accession
UniGene Hs.279761
5'-terminal sequence TGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTG
2011.08.28